Whole Mouse Pup (FFPE) with 5K Mouse Pan Tissue and Pathways Panel and Snap25a/Snap25b Add-on
In Situ Gene Expression dataset analyzed using Xenium Onboard Analysis 3.0.0
Learn about Xenium analysis
Overview
Xenium Prime 5K In Situ Gene Expression with Cell Segmentation data for a 1 day old mouse pup (FFPE) using the Xenium Prime 5K Mouse Pan Tissue and Pathways Panel, supplemented with add-on probes for the canonical Snap25a / Snap25b isoforms.
How to view data
Interactively explore data with Xenium Explorer by downloading the Xenium Output Bundle (or Xenium Explorer subset) file. The subset bundle contains the experiment.xenium, gene_panel.json, morphology_focus/ directory of multi-file OME-TIFF files, analysis_summary.html, cells.zarr.zip, cell_feature_matrix.zarr.zip, transcripts.zarr.zip, and analysis.zarr.zip files.
Note: for large Xenium datasets such as this one with > 200 million unique cell by transcript features (sparse matrix), Xenium Explorer v3.0+ does not support certain transcript and cell functions due to performance limits. See more information here.
See the Getting Started with Xenium Explorer page for more details. Follow these instructions to view the post-Xenium H&E image or image alignment file in Xenium Explorer.
Biomaterials
FFPE-preserved P1 mouse pup was purchased from AcePix Biosciences (Mouse C57BL/6, non-diseased, male, 9 weeks old).
Tissue preparation
Tissues were prepared following the Demonstrated Protocols Xenium In Situ for FFPE - Tissue Preparation Guide (CG000578) and Xenium In Situ for FFPE Tissues – Deparaffinization & Decrosslinking (CG000580).
Probe hybridization, washing, ligation, amplification, and cell segmentation staining were performed following the Xenium Prime In Situ Gene Expression with optional Cell Segmentation Staining User Guide (CG000760).
Post-instrument processing followed the Demonstrated Protocol Xenium In Situ Gene Expression - Post-Xenium Analyzer H&E Staining (CG000613).
Gene panels
The Xenium Prime 5K Mouse Pan Tissue and Pathways Panel was designed to enable comprehensive cell type and cell state identification using publicly available single cell RNA sequencing data. The panels also cover canonical signaling pathways, as well as genes relevant to developmental biology and genes that are well known in biomedical literature.
In addition to the Xenium Prime 5K Mouse Pan Tissue and Pathways Panel, add-on probes were included for the canonical Snap25a (Snap25-201) / Snap25b (Snap25-202) isoforms. These isoforms are distinguished by a mutually exclusive fifth exon. To analyze these isoforms, a pair of probes were made for the exon-exon junction of each isoform (exon 4 to exon 5, and exon 5 to exon 6). The probe sequences of the concatenated 5' and 3' sides of the ligation junction (binder) are shown below for each isoform:
name,binder
Snap25a_exon4_exon5,TTTGGTTATGTTGGATGAGCAAGGCGAACAACTGGAACGC
Snap25a_exon5_exon6,GGCTTTGTGTGTGTCCCTGTAACAAGCTTAAATCCAGTGA
Snap25b_exon4_exon5,GACTTTGGTTATGTTGGATGAGCAAGGCGAACAACTCGAT
Snap25b_exon5_exon6,GCCTTTTCATATGTCCTTGTAACAAGCTTAAATCCAGTGA
Xenium Analyzer
The instrument run was performed following the Xenium Analyzer User Guide CG000584. The on-instrument analysis was run with Xenium Onboard Analysis v3.0.0.
| Metric | Whole mouse |
|---|---|
| Median transcripts per cell | 241 |
| Cells detected | 1,298,870 |
| Nuclear transcripts per 100 µm² | 540.6 |
| High quality decoded transcripts detected | 523,674,865 |
| Region area (µm²) | 224,148,512.8 |
This dataset is licensed under the Creative Commons Attribution license.